View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14243_high_20 (Length: 218)
Name: NF14243_high_20
Description: NF14243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14243_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 19 - 202
Target Start/End: Complemental strand, 54892879 - 54892696
Alignment:
| Q |
19 |
gagaaatgaaatttgatcttacaatgttggattttgcagcagagtccatctgattaaccaaggagcatcaaagccatgaaagttactccagtcttggagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54892879 |
gagaaatgaaatttgatcttacaatgttggattttgcagcagagtccatctgattaaccaaggagcatcaaagccatgaaagttactccagtcttggagc |
54892780 |
T |
 |
| Q |
119 |
tgtttcatcgagaagtttaactagaagcttggatttatcttaaaattttatttcttgcatcccaagactatttgaactagaatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54892779 |
tgtttcatcgagaagtttaactagaagcttggatttatcttaaaattttatttcttgcatcccaagactatttgaactagaatt |
54892696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University