View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14243_high_21 (Length: 217)
Name: NF14243_high_21
Description: NF14243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14243_high_21 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 128 - 217
Target Start/End: Complemental strand, 10165115 - 10165026
Alignment:
| Q |
128 |
gtcgtcttagtacaacatttgatttgttggtcggtcttgatgcaaaattgtttttacttttccttcttgtttcggtgtcatttcagttca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10165115 |
gtcgtcttagtacaacatttgatttgttggtcggtcttgatgcaaagttgtttttacttttccttcttgtttcggtgtcatttcagttca |
10165026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 10165242 - 10165202
Alignment:
| Q |
1 |
tcaatgttcacctctatatttcttcagagaagtttaaggcc |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10165242 |
tcaatgttcacctctatatttcttcagagaagtttaaggcc |
10165202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University