View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14243_high_22 (Length: 201)
Name: NF14243_high_22
Description: NF14243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14243_high_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 34267684 - 34267851
Alignment:
| Q |
18 |
aaaagatagacgcaattattttcaagttttattgtgttttcatctctctaaatgnnnnnnnttgagaagatctcaactcattttctactatgtaaaaatt |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34267684 |
aaaagatagacgcaattatttttaagttttattgtgttttcatctctctaaatggaaaaaattgagaggatctcaactcattttctactatgtaaaaatt |
34267783 |
T |
|
| Q |
118 |
agtgattagtttacgagttacatcaagcaacttggtatggagatatttgataacatgactctccccta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34267784 |
agtgattagtttacgagttacatcaagctacttggtatggagatatttgataacatgactctccccta |
34267851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University