View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14243_high_7 (Length: 384)
Name: NF14243_high_7
Description: NF14243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14243_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 18 - 367
Target Start/End: Original strand, 46791032 - 46791381
Alignment:
| Q |
18 |
aggtataataaataaggaaacgcaagattggaataatgaaattgattgtagggttgccgcaacggtgagataatttacaaactaggcatccaattgagag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46791032 |
aggtataataaataaggaaacgcaagattggaataatgaaattgattgtagggttgccgcaacggtgagataatttacaaactaggcatccaattgagag |
46791131 |
T |
 |
| Q |
118 |
cagttggaacttggatggatgcatttccctttattgattttcaagggagggggaagatccaatccaacctaattcacaagtcaacttgtcacatcacaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46791132 |
cagttggaacttggatggatgcatttccctttattgattttcaagggagggggaagatccaatccaacctaattcacaagtcaacttgtcacatcacaat |
46791231 |
T |
 |
| Q |
218 |
gaatgcttttgcaatttgcaatgatatttataaactatgcagggaaatcgtagccaaaacttctttaacaactttgctctttattatcaaaccagtggag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46791232 |
gaatgcttttgcaatttgcaatgatatttataaactatgcagggaaatcgtagccaaaacttctttaacaactttgctctttattatcaaaccagtggag |
46791331 |
T |
 |
| Q |
318 |
ccagccagctgattcacaactggttttgttaaactaataattatcttcgt |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46791332 |
ccagccagctgattcacaactggttttgttaaactaataattatcttcgt |
46791381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University