View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14243_low_12 (Length: 334)
Name: NF14243_low_12
Description: NF14243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14243_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 302
Target Start/End: Original strand, 38666653 - 38666936
Alignment:
| Q |
19 |
agcgacgacgccgacggcttgggattcggagannnnnnnagtttcttcgcgggagagaattggagcgagagaggagaaatctttgagtgttcgttttgct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666653 |
agcgacgacgccgacggcttgggattcggagagagggggagtttcttcgcgggagagaattagagcgagagaggagaaatctttgagtgttcgttttgct |
38666752 |
T |
 |
| Q |
119 |
ttgaggagattcttgcttggagcttcgtgtttagggttttgatttctggcggagatttggaagtggtggagaagtcgaggggcggcggtggccaccgtgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666753 |
ttgaggagattcttgcttggagcttcgtgtttagggttttgatttctggcggagatttggaagtggtggagaagtcgaggggcggcggtggccaccgtgc |
38666852 |
T |
 |
| Q |
219 |
gttggtggcggatgatggagaatgatgcgagcgacatcttgaaggagagagagaattgagatttcaaagccttttttgaaacgg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666853 |
gttggtggcggatgatggagaatgatgcgagcgacatcttgaaggagagagagaattgagatttcaaagccttttttgaaacgg |
38666936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University