View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14243_low_18 (Length: 255)
Name: NF14243_low_18
Description: NF14243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14243_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 388827 - 389005
Alignment:
| Q |
18 |
aaagagaggttgttatggctcaaagtagcaaatgctcactttaaatttttccatggcgtgatgacttgtaagaaacggggaaatgcaatttctatgacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
388827 |
aaagagaggttgttatggctcaaagtagcaaatgctcactctaaatttttccatggcgtgatgactcgtaagaaacggggaaatgcaatttctatgacaa |
388926 |
T |
 |
| Q |
118 |
agtggaaagagtaaccaatgttt-aaatgacgtgttcacacattttaattataatttccggtatgttcttcttgtgcga |
195 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
388927 |
agtggaaagagtaaccaatgtttaaaatgatgtgttcacacattttaattataatttccggtatgtttttcttgagcga |
389005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 194 - 235
Target Start/End: Original strand, 389087 - 389128
Alignment:
| Q |
194 |
gaggttaagatgacagtttgagattgtgatatttttaagagt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
389087 |
gaggttaagatgacagtttgagattgtgatatttttaagagt |
389128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University