View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14243_low_24 (Length: 237)

Name: NF14243_low_24
Description: NF14243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14243_low_24
NF14243_low_24
[»] chr7 (2 HSPs)
chr7 (1-108)||(22557503-22557610)
chr7 (180-221)||(22557391-22557432)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 22557610 - 22557503
Alignment:
1 tatcataattatataactaacacagatgtcattatcgtataaatggccataggaaccaaaaactttgagcctcacattgtgaaggagccaaacattggtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22557610 tatcataattatataactaacacagatgtcattatcgtataaatggccataggaaccaaaaactttgagcctcacattgtgaaggagccaaacattggtt 22557511  T
101 cggggaac 108  Q
    ||||||||    
22557510 cggggaac 22557503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 22557432 - 22557391
Alignment:
180 tgactatatacaactgttagattgtgaaagcttacatctata 221  Q
    ||||||||||||||||||||||||||||||||||||||||||    
22557432 tgactatatacaactgttagattgtgaaagcttacatctata 22557391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University