View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14243_low_24 (Length: 237)
Name: NF14243_low_24
Description: NF14243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14243_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 22557610 - 22557503
Alignment:
| Q |
1 |
tatcataattatataactaacacagatgtcattatcgtataaatggccataggaaccaaaaactttgagcctcacattgtgaaggagccaaacattggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22557610 |
tatcataattatataactaacacagatgtcattatcgtataaatggccataggaaccaaaaactttgagcctcacattgtgaaggagccaaacattggtt |
22557511 |
T |
 |
| Q |
101 |
cggggaac |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
22557510 |
cggggaac |
22557503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 22557432 - 22557391
Alignment:
| Q |
180 |
tgactatatacaactgttagattgtgaaagcttacatctata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22557432 |
tgactatatacaactgttagattgtgaaagcttacatctata |
22557391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University