View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14243_low_25 (Length: 237)
Name: NF14243_low_25
Description: NF14243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14243_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 41315539 - 41315310
Alignment:
| Q |
1 |
cagactaattggttattttcaagtagcttagcct-gcgggaggagaagaacaagacagcacatcacaataaaattctcattcctctgctgtctgtct--- |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41315539 |
cagactaattggttattttcaagtagcttagccttgcgggaggacaagaacaagacagcacatcacaataaaattctcattcctctgctgtctgtctgtc |
41315440 |
T |
|
| Q |
97 |
-----tcaacattatgatgatcaattcaactctaccatcacacaaccttaacatgttccaaactagacaacaatccaccttcacatgccgatcatcctct |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41315439 |
tgtcttcaacattatgatgatcaattcaactctaccatcacacaaccttaacatgttccaaactagacaacaatccaccttcacatgccgatcatcctct |
41315340 |
T |
|
| Q |
192 |
tccattaacaaccaactcccacctcgtaaa |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
41315339 |
tccattaataaccaactcccacctcgtaaa |
41315310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University