View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14243_low_7 (Length: 402)
Name: NF14243_low_7
Description: NF14243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14243_low_7 |
 | |
|
| [»] chr7 (8 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 2e-90; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 211 - 402
Target Start/End: Original strand, 7278608 - 7278802
Alignment:
| Q |
211 |
ataaagcttccactttgtcaccttcctcatcttcaccacccccctccttcatcaaaaaattatattct---ttcacacatttaccctcgctaccatcctc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||| |
|
|
| T |
7278608 |
ataaagcttccactttgtcaccttcctcatcttcaccacccccctccttcatcaaaaaatgatcttcttctttcacacatttaccctcgctaccatcctc |
7278707 |
T |
|
| Q |
308 |
attcatcaaaggtcccattttttcacctccctcattcttctcttcacaccccctctcttctttctccatacaattcacctcgccatcctcattca |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7278708 |
attcatcaaaggtcccattttttcacctccctcattcttctcttcacaccccctctcttctttctccatacaattcacctcaccatcctcattca |
7278802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 211 - 402
Target Start/End: Complemental strand, 7375231 - 7375037
Alignment:
| Q |
211 |
ataaagcttccactttgtcaccttcctcatcttcaccacccccctccttcatcaaaaaattatattctt---tcacacatttaccctcgctaccatcctc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
7375231 |
ataaagcttccactttgtcaccttcctcatcttcaccacccccctccttcatcaaaaaatgatcttcttctttcacacatttaccctcgctaccatcctc |
7375132 |
T |
|
| Q |
308 |
attcatcaaaggtcccattttttcacctccctcattcttctcttcacaccccctctcttctttctccatacaattcacctcgccatcctcattca |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7375131 |
attcatcaaaggtcccattttttcacctccctcattcttctcttcataccccctctcttctttctccatacaattcacctcgccatcctcattca |
7375037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 49 - 152
Target Start/End: Original strand, 7278446 - 7278549
Alignment:
| Q |
49 |
cttcctcccccaaacttgttcccacactctcttccttctcttctacctccatcttcttcacatcctcattgctctcctcattccccaaagcttcaaattt |
148 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7278446 |
cttcctccaccaaacttgttcccacactctcttccttctcttctacctccatcttcttcacatcctcattgttctcctcattccccaaagcttcaaattt |
7278545 |
T |
|
| Q |
149 |
ttca |
152 |
Q |
| |
|
|||| |
|
|
| T |
7278546 |
ttca |
7278549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 49 - 152
Target Start/End: Complemental strand, 7375393 - 7375290
Alignment:
| Q |
49 |
cttcctcccccaaacttgttcccacactctcttccttctcttctacctccatcttcttcacatcctcattgctctcctcattccccaaagcttcaaattt |
148 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7375393 |
cttcctccaccaaacttgttcccacactctcttccttctcttctacctccatcttcttcacatcctcattgttctcctcattccccaaagcttcaaattt |
7375294 |
T |
|
| Q |
149 |
ttca |
152 |
Q |
| |
|
|||| |
|
|
| T |
7375293 |
ttca |
7375290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 383
Target Start/End: Original strand, 7278789 - 7278873
Alignment:
| Q |
299 |
accatcctcattcatcaaaggtcccattttttcacctccctcattcttctcttcacaccccctctcttctttctccatacaattc |
383 |
Q |
| |
|
|||||||||||||| ||||| | | ||||| | ||| |||||||||| ||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
7278789 |
accatcctcattcaccaaagcttcaattttattaccaccctcattctcctcttcacaccccacctcttccttctccaaacaattc |
7278873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 300 - 383
Target Start/End: Complemental strand, 7375049 - 7374966
Alignment:
| Q |
300 |
ccatcctcattcatcaaaggtcccattttttcacctccctcattcttctcttcacaccccctctcttctttctccatacaattc |
383 |
Q |
| |
|
||||||||||||| ||||| | | ||||| | ||| |||||||||| ||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
7375049 |
ccatcctcattcaccaaagcttcaattttattaccaccctcattctcctcttcacaccccacctcttccttctccaaacaattc |
7374966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 376
Target Start/End: Original strand, 7278543 - 7278593
Alignment:
| Q |
326 |
tttttcacctccctcattcttctcttcacaccccctctcttctttctccat |
376 |
Q |
| |
|
|||||||||||||||||||| ||| | ||||||||| ||||||| |||||| |
|
|
| T |
7278543 |
tttttcacctccctcattctcctccttacaccccctatcttcttcctccat |
7278593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 376
Target Start/End: Complemental strand, 7375296 - 7375246
Alignment:
| Q |
326 |
tttttcacctccctcattcttctcttcacaccccctctcttctttctccat |
376 |
Q |
| |
|
|||||||||||||||||||| ||| | ||||||||| ||||||| |||||| |
|
|
| T |
7375296 |
tttttcacctccctcattctcctccttacaccccctatcttcttcctccat |
7375246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University