View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14244_high_1 (Length: 496)
Name: NF14244_high_1
Description: NF14244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14244_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-107
Query Start/End: Original strand, 23 - 257
Target Start/End: Complemental strand, 13073153 - 13072920
Alignment:
| Q |
23 |
atgatgatgatgaattgttaggtttcttctttggaggcattttagggttttgtgtttcggttcagannnnnnnattgtgaattgtgaatatttgaaatga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13073153 |
atgatgatgatgaattgttaggtttcttctttggaggcattttagggttttgtgtttcggttcagattttg--attgtgaattgtgaatatttgaaatga |
13073056 |
T |
 |
| Q |
123 |
gaagtgacgaaattttgatgctttgattttcccgcgttcacaatttcggggctcacttcacttcattcacgggtttcgatttgcgcccaacaagaaaggg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13073055 |
gaagtgacgaaattttgatgctttgattttcccgcgttcacaatttcagggctcacttcacttcattcacgggtttcgatttgcgcccaacaagaaaggg |
13072956 |
T |
 |
| Q |
223 |
tattatagggtaaaatttcc-aagaaaggaataaag |
257 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13072955 |
tattatagggtaaaatttccaaagaaaggaataaag |
13072920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 352 - 409
Target Start/End: Complemental strand, 13072809 - 13072752
Alignment:
| Q |
352 |
atagaagaaatggtaaagtcatcatgaaaaaatagatattctaatcgtgtaatttgat |
409 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13072809 |
atagaaaaaatggtaaagtcatcatgaaaaaatagatattctaatcgtgtaatttgat |
13072752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University