View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14244_low_11 (Length: 227)
Name: NF14244_low_11
Description: NF14244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14244_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 213
Target Start/End: Complemental strand, 54217428 - 54217226
Alignment:
| Q |
12 |
tattctcaattttagtaatagatcttttcattgtcatttttt-actgatgtagaataaatcgtagattttagtgattcatgttgaatttaatcacataaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54217428 |
tattctcaattttagtaatagatcttttcattgtcatttttttactgatgtagaataaattgtagattttagtgattcatgttgaatttaatcacataaa |
54217329 |
T |
 |
| Q |
111 |
caatctgcttacccaagagcaactctaacaatcataagactgtcatcttcataaaagcaagatgcccacccaaattcatactgcaccaaaatgaagtgtt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54217328 |
caatctgcttacccaagagcaactctaacaatcataagactgtcatcttcataaaagcaagatgcccacccaaattcatactgcaccaaaatgaagtgtt |
54217229 |
T |
 |
| Q |
211 |
ttt |
213 |
Q |
| |
|
||| |
|
|
| T |
54217228 |
ttt |
54217226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University