View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14245_high_23 (Length: 308)
Name: NF14245_high_23
Description: NF14245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14245_high_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 19 - 161
Target Start/End: Complemental strand, 36586041 - 36585899
Alignment:
| Q |
19 |
attcctacccaagattttttcactaatgaatttggacttccattaacaatgattccaagtatgtcttcttgtctttcataacaagacaaaagttcttcta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36586041 |
attcctacccaagattttttcactaatgaatttggacttccattaacaatgattccaagtatgtcttcttgtctttcataacaagacaaaagttcttcta |
36585942 |
T |
|
| Q |
119 |
gttcacattctttacaataatgactaaagtatgacttgaccaa |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36585941 |
gttcacattctttacaataatgactaaagtatgacttgaccaa |
36585899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 218 - 293
Target Start/End: Complemental strand, 36585842 - 36585767
Alignment:
| Q |
218 |
catctatatgaatttaatctcagattttgaagacatgagttgtgatatggtttatggccaaactccgccttcattt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36585842 |
catctatatgaatttaatctcagattttgaagacatgagttgtgatatggtttatggccaaactccgccttcattt |
36585767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University