View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14245_high_25 (Length: 285)
Name: NF14245_high_25
Description: NF14245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14245_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 123 - 263
Target Start/End: Complemental strand, 52672564 - 52672423
Alignment:
| Q |
123 |
caaggagaaatggttcgttttacaagagattaataaggctgatgttataatctgctgccacagctttgagacttctccgtgccaaattcaaactcactta |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52672564 |
caaggagaaatggttcgttttacaagagattaataaggctgatgttataatctgctgccacagctttgagacttatccgtgccaaattcaaactcactta |
52672465 |
T |
|
| Q |
223 |
ttcagtttcattgccgattcaatccaccgttt-gtatatatt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52672464 |
ttcagtttcattgccgattcaatccaccgtttggtatatatt |
52672423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University