View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14245_high_29 (Length: 259)
Name: NF14245_high_29
Description: NF14245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14245_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 14 - 245
Target Start/End: Original strand, 5549285 - 5549516
Alignment:
| Q |
14 |
gaacatcatttgtagaaattaataaaagggtttcttaatatttaataattttgtagttattccaaaattagatatattattttagtactttattttatat |
113 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5549285 |
gaacatcatgtgtagaaattaataaaagggtttcttaatattttataattttgtagatattccaaaattagatatattattttagtactttattttatat |
5549384 |
T |
 |
| Q |
114 |
cacatccaatcagattttgacatgatgactgaagaatgagatcattggannnnnnnnnnnnnnaaacagttgtttttaaggttcagaaaattaccaagaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5549385 |
cacatccaatcagattttgacatgatgactgaagaatgagatcattggattttttttctttttaaacagttgtttttaaggttcagaaaattaccaagaa |
5549484 |
T |
 |
| Q |
214 |
atatggatgatttgaccatcaacagagacaag |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5549485 |
atatggatgatttgaccatcaacagagacaag |
5549516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University