View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14245_high_33 (Length: 202)

Name: NF14245_high_33
Description: NF14245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14245_high_33
NF14245_high_33
[»] chr7 (1 HSPs)
chr7 (6-180)||(31626832-31627006)


Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 6 - 180
Target Start/End: Original strand, 31626832 - 31627006
Alignment:
6 agtgacggcggagatggcgaggagatgaataggtctttaagcttgtggcggactttgacttcatcggaggaaggaggaggtggatctaggggaggaggat 105  Q
    ||||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
31626832 agtgacggcggagatggagaggagacgaataggtctttaagcttgtggcgaactttgacttcatcggaggaaggaggaggtggatctaggggaggaggat 31626931  T
106 ggaaacggcggcggtcgtgaggacgagtgaggaacatgcgaagggttttgcggcggcggaggtggatgacgggac 180  Q
    ||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
31626932 ggaaacggcggcggtcgtgcggacgagtgaggaacatgcggagggttttgcggcggcggaggtggatgacgggac 31627006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University