View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14245_low_25 (Length: 291)
Name: NF14245_low_25
Description: NF14245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14245_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 36 - 272
Target Start/End: Original strand, 5549524 - 5549760
Alignment:
| Q |
36 |
ggttaataatcttcaatgtgttatgactatataaatactatgattgacatctttgacatgaaattgaaaatggtagaatcatgcttatgtaagaattgac |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5549524 |
ggttaataatcttcaatgtgttatgactatataaatactatgattgacacctttgacatgaaattgaaaatggtagaatcatgcttatgtaagaactgac |
5549623 |
T |
|
| Q |
136 |
aaccagaattcatagaaaggtaaagtataaacccaataaatcagattagtaaagtagtaaaaggtannnnnnnnaatcatttctttgctaatttcgtcct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5549624 |
aaccagaattcatagaaaggtaaagtataaacccaataaatcagattagtaaagtagtaaaaggtattttttttaatcatttctttgctaatttcgtcct |
5549723 |
T |
|
| Q |
236 |
agtaattttgatttaatttactcaacctaacacttac |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5549724 |
agtaattttgatttaatttactcaacctaacacttac |
5549760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University