View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14245_low_36 (Length: 202)
Name: NF14245_low_36
Description: NF14245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14245_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 6 - 180
Target Start/End: Original strand, 31626832 - 31627006
Alignment:
| Q |
6 |
agtgacggcggagatggcgaggagatgaataggtctttaagcttgtggcggactttgacttcatcggaggaaggaggaggtggatctaggggaggaggat |
105 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31626832 |
agtgacggcggagatggagaggagacgaataggtctttaagcttgtggcgaactttgacttcatcggaggaaggaggaggtggatctaggggaggaggat |
31626931 |
T |
 |
| Q |
106 |
ggaaacggcggcggtcgtgaggacgagtgaggaacatgcgaagggttttgcggcggcggaggtggatgacgggac |
180 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31626932 |
ggaaacggcggcggtcgtgcggacgagtgaggaacatgcggagggttttgcggcggcggaggtggatgacgggac |
31627006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University