View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14246_high_12 (Length: 402)
Name: NF14246_high_12
Description: NF14246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14246_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 382; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 1 - 398
Target Start/End: Original strand, 7624350 - 7624747
Alignment:
| Q |
1 |
tgtctcttacatttcattcacccatctttattatttctcttctctttctagcaaacatcaatgaatcaatgatatatcttaccttcagtgttgttcaaat |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7624350 |
tgtctcttacgtttcattcacccatctttattatttctcttctctttctagcaaacatcaatgaatcaatgatatatcttaccttcagtgttgttcaaat |
7624449 |
T |
 |
| Q |
101 |
ttcaacatgcaataatgctgctatttgacaacattgtttacgtataaatctctgtggtttgaccatctttcggtttgtcaatctcccttaatgttcttac |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7624450 |
ttcaccatgcaataatgctgctatttgacaacattgtttacgtataaatctctgtggtttgaccatctttcggtttgtcaatctcccttaatgttcttac |
7624549 |
T |
 |
| Q |
201 |
gacaattttttgttgcctcctagcctttatcaccagttttcatcactaggtttggtcatattatcattgatattttaaacttgtttttaatgtatggtcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7624550 |
gacaattttttgttgcctcctagcctttatcaccagttttcatcactaggtttggtcatattatcattgatattttaaacttgtttttaatgtatggtcc |
7624649 |
T |
 |
| Q |
301 |
acggtggaccatttatgaacacattgtcatattagaatttgccatccccccatattgtggcttaaacaacaaacacgtttttatcacctatgcttctc |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7624650 |
acggtggaccatttatgaacacattgtcatattagaatttgccatccccccatactgtggcttaaacaacaaacacgtttttatcacccatgcttctc |
7624747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University