View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14246_high_7 (Length: 468)
Name: NF14246_high_7
Description: NF14246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14246_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 408; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 408; E-Value: 0
Query Start/End: Original strand, 1 - 451
Target Start/End: Complemental strand, 27168197 - 27167744
Alignment:
| Q |
1 |
accctaaattccttaacaccagcttttgttgcgtaacggaagtccccttcgacgttcatgatctcgtggtttccgttcatggttatgattctgccgc--- |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27168197 |
accctaaattccttaacaccagcttttgttgcgtaacggaagtccccttcgacgttcatgatctcgtggtttccgttcatggttatgattctgccgccgc |
27168098 |
T |
 |
| Q |
98 |
aacgtgcggcttctcgtttcagcttctcaagaatgtaaagaatcttgagctcacagcctccgcggtcaaggatgtcgccaacttggactacagtggtgga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27168097 |
aacgtgcggcttctcgtttcagcttctcaagaatgtaaagaatcttgagctcacggcctccgcggtcaaggatgtcgccaacttggactacagtggtgga |
27167998 |
T |
 |
| Q |
198 |
acctccaatgtatctgtccgaggagtcaattatgccggcaaggtgcagcgcttgcttggtcttgttgaagtccccatggaggtcgccgatagcgatcagg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27167997 |
acctccaatgtatctgtccgaggagtcaattatgccggcaaggcgcagagcttgcttggtcttattgaagtccccgtggaggtcgccgatagcgatcagg |
27167898 |
T |
 |
| Q |
298 |
cgtggcgacgagggaaggcgggtgggaggcttagatgtcatcgtaggcagcggcggtgggaggaagagaccgctgactgagaaatcaacaaaggtatcaa |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27167897 |
cgtggcgacgagggaaggcgggtgggaggcttagatgtcatcgtaggtggcggcggtgggaggaagagaccgctgactgagaaatcaacaaaggtatcaa |
27167798 |
T |
 |
| Q |
398 |
cgaaagaagataggagattgggaatgtctttgcatgcaaatgaggttgagttca |
451 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27167797 |
cgaaagaagataggagattaggaatgtctttgcatgcaaatgaggttgagttca |
27167744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University