View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14246_low_19 (Length: 265)
Name: NF14246_low_19
Description: NF14246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14246_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 4e-44; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 12693430 - 12693332
Alignment:
| Q |
1 |
ataataggaaaataattattaatacttcgttaggtatcaaaaagagacttataatttttaaagagaattagacataaaatatactctaaaatgtccagg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12693430 |
ataataggaaaataattattaatacttctttaggtatcaaaaagagacttataatttttaaagagaattagacataaaatatactctaaagtgtccagg |
12693332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 200 - 247
Target Start/End: Complemental strand, 12693149 - 12693102
Alignment:
| Q |
200 |
ctccataaaatgtgtatcaaattacggctataaatagaaagttctgcc |
247 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12693149 |
ctccatagaatgtgtatcaaattacggctataaatagaaagttctgcc |
12693102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 66 - 99
Target Start/End: Complemental strand, 12693274 - 12693241
Alignment:
| Q |
66 |
aattagacataaaatatactctaaaatgtccagg |
99 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
12693274 |
aattagacataaaatatactctaaagtgtccagg |
12693241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University