View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14246_low_23 (Length: 234)
Name: NF14246_low_23
Description: NF14246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14246_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 41606342 - 41606549
Alignment:
| Q |
11 |
gtgaaataaaaagcttggtaaaccagtaattaattaagag--ttaagacactaacatatacctagaaatttcattccacaagggtgctttctgattattc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41606342 |
gtgaaataaaaagcttggtaaaccagtaattaattaagagagttaagacactaacatatacctagaaatttcattccacaagggtgctttctgattattc |
41606441 |
T |
|
| Q |
109 |
tctctgaacttagaatcaagacgagatctgatttctagaagagaaagagtctcttgtctaggccatctgttgttacaagaatcaaagttaccaagccatc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41606442 |
tctctgaacttagaatcaagacgagatctgatttctagaagagaaagagtctcttgtctgggccatctgttgttacaagaatcaaagttaccaagccatc |
41606541 |
T |
|
| Q |
209 |
ctttatca |
216 |
Q |
| |
|
|||||||| |
|
|
| T |
41606542 |
ctttatca |
41606549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 26598053 - 26598001
Alignment:
| Q |
124 |
tcaagacgagatctgatttctagaagagaaagagtctcttgtctaggccatct |
176 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||| |||||||| |||||||| |
|
|
| T |
26598053 |
tcaagacgagatctgatttcaagaagagtaagagtttcttgtcttggccatct |
26598001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University