View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14247_high_16 (Length: 213)

Name: NF14247_high_16
Description: NF14247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14247_high_16
NF14247_high_16
[»] chr7 (2 HSPs)
chr7 (130-198)||(38679437-38679505)
chr7 (1-48)||(38679587-38679634)


Alignment Details
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 130 - 198
Target Start/End: Complemental strand, 38679505 - 38679437
Alignment:
130 ctaaacaaaatcagtttagtcccattaaaatagaaacaattccactgttcaacaggaactaatatatac 198  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||    
38679505 ctaaacaaaatcagtttagtcccattaaaatagaaacaattccgctgttcaacaagaactaatatatac 38679437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 38679634 - 38679587
Alignment:
1 acgtgtaatattaaaatctatatcgaaaataaatgagtttaagctaga 48  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
38679634 acgtgtaatattaaaatctatatcgaaaataaatgagtttaagctaga 38679587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University