View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14247_low_17 (Length: 228)
Name: NF14247_low_17
Description: NF14247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14247_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 14 - 109
Target Start/End: Complemental strand, 3428922 - 3428827
Alignment:
| Q |
14 |
atagggaagaaggaaggagccctaagatcgattctaatgtgccatcttcctttcaattgtatctttcctatttcagtctccaaggtaatctcaata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3428922 |
atagggaagaaggaaggagccctaagatcgattctaatgtgccatcttcctttcaattgtatctttcctatttcagtctccaaggtaatctcaata |
3428827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 3428761 - 3428719
Alignment:
| Q |
171 |
ctaaggtttggataaatcagaagtaattgggaatgtaaatagt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3428761 |
ctaaggtttggataaatcagaagtaattgggaatgtaaatagt |
3428719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University