View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14247_low_4 (Length: 479)
Name: NF14247_low_4
Description: NF14247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14247_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 7e-50; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 92 - 247
Target Start/End: Original strand, 43059042 - 43059194
Alignment:
| Q |
92 |
ccaacaacattacatcttatatgtttctattttatctttatatattagaagaaaat---ggtaaaactatgcaatgtaaataatagaaatagtcaaatta |
188 |
Q |
| |
|
|||||||||| |||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43059042 |
ccaacaacatcacatcttatatgttactcttttatctttatatattagaagaaaattatggtaaaactatgcaatgtaaataatagaaatagtcaaatta |
43059141 |
T |
 |
| Q |
189 |
attatgtcactcattgtgggatggaggaactaggaagtagtattaaaagagaaagcatg |
247 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43059142 |
----tgtcac--attgtgggatggaggaactcggaagtagtattaaaagagaaagcatg |
43059194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 43058698 - 43058740
Alignment:
| Q |
1 |
accttgtgattaagtgactttaaactttagtatattacttctc |
43 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43058698 |
acctcgtgattaagtgactttaaactttagtattttacttctc |
43058740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 242 - 276
Target Start/End: Original strand, 43059370 - 43059404
Alignment:
| Q |
242 |
agcatgcatgaagaaggaatgcaaactggttatcg |
276 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43059370 |
agcatacatgaagaaggaatgcaaactggttatcg |
43059404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University