View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14248_high_11 (Length: 283)
Name: NF14248_high_11
Description: NF14248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14248_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 142 - 274
Target Start/End: Complemental strand, 43029691 - 43029559
Alignment:
| Q |
142 |
cactcacttgctggaagacagacagatagtcacagagtgatggattgatggggccaattggttttaaaaagtgtcatgttttctcatttgtcactttctc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43029691 |
cactcacttgctggaagacagacagatagtcacagagtgatggattgatggggccaattggtttttaaaagtgtcatgttttctcatttgtcactttctc |
43029592 |
T |
|
| Q |
242 |
tttggtttatataatgttaatgcctttgcttct |
274 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||| |
|
|
| T |
43029591 |
tttggtttatgtaatgttaatgcctttgattct |
43029559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 13 - 82
Target Start/End: Complemental strand, 43029820 - 43029751
Alignment:
| Q |
13 |
gaagaaggaggtggagaaaagacagaatcatggtcttctccattttgggatgtagatacagaatgattct |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43029820 |
gaagaaggaggtggagaaaagacagaatcatggtcttctccattttgggatgtagatacagaatgattct |
43029751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University