View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14248_high_17 (Length: 211)

Name: NF14248_high_17
Description: NF14248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14248_high_17
NF14248_high_17
[»] chr4 (1 HSPs)
chr4 (32-116)||(6089230-6089314)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 32 - 116
Target Start/End: Complemental strand, 6089314 - 6089230
Alignment:
32 aggaggaggaagtggtggttcagttccatttactggatatgcttctgttttgaaggattctaggtttttgaaaccagctcaagaa 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6089314 aggaggaggaagtggtggttcagttccatttactggatatgcttctgttttgaaggattctaggtttttgaaaccagctcaagaa 6089230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University