View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14248_low_13 (Length: 318)
Name: NF14248_low_13
Description: NF14248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14248_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 235 - 286
Target Start/End: Complemental strand, 3003825 - 3003775
Alignment:
| Q |
235 |
atttatgtttgtttcttggttatttcatatccatcaacctcactggttatta |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
3003825 |
atttatgtttgtttcttggttatttcatatcta-caacctcactggttatta |
3003775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 76 - 133
Target Start/End: Complemental strand, 15202499 - 15202442
Alignment:
| Q |
76 |
ggaactaggagtggtgacttttgaaagtttgaattaagaaggcatattgagattagta |
133 |
Q |
| |
|
|||||||||||| || ||||||||| |||| ||||||||||||| || ||||||||| |
|
|
| T |
15202499 |
ggaactaggagttgtagcttttgaaaatttgcattaagaaggcatgttaagattagta |
15202442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University