View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14248_low_16 (Length: 291)
Name: NF14248_low_16
Description: NF14248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14248_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 3e-48; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 14 - 119
Target Start/End: Original strand, 31737563 - 31737668
Alignment:
| Q |
14 |
ttctggactggtctagtattgattaacttatttttgtctgaggtaaaaaccatggactttggatccctttcaaatgatagactaccgcaatggtaataaa |
113 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31737563 |
ttctggactggtctagtattgattcacttatttttgtctgaggtaaaaaccatggactttggatcactttcaaatgatagactaccgcaatggtaataaa |
31737662 |
T |
 |
| Q |
114 |
aatctt |
119 |
Q |
| |
|
|||||| |
|
|
| T |
31737663 |
aatctt |
31737668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 119
Target Start/End: Original strand, 31703182 - 31703285
Alignment:
| Q |
15 |
tctggactggtctagtattgattaacttatttttgtctgaggtaaaaaccatggactttggatccctttcaaatgatagactaccgcaatggtaataaaa |
114 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||||||||| || | |||||||||| |
|
|
| T |
31703182 |
tctggactg-tctagtattgattaacttatttttgtccgaggtaaaaactatggactttggatcactttccaatgatagactatcgtgacggtaataaaa |
31703280 |
T |
 |
| Q |
115 |
atctt |
119 |
Q |
| |
|
||||| |
|
|
| T |
31703281 |
atctt |
31703285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 117 - 209
Target Start/End: Original strand, 31737700 - 31737791
Alignment:
| Q |
117 |
cttaataaaattttgtattggtactataaactaatgtaatatcagggcaaaatcgatcannnnnnnngcttctaatgccctacttaggtgttc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31737700 |
cttaataaaattttgtattggtactataaactaatgtaatatcagggcaaaatcgatca-tttttttgcttctaatgccctacttaggtgttc |
31737791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University