View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14249_high_11 (Length: 249)
Name: NF14249_high_11
Description: NF14249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14249_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 3188942 - 3188704
Alignment:
| Q |
1 |
ttcttcaatcacttcaagtataaacaattatttcttctcattaatatgtgttctgttctgagcaatgtttaaatcagagtattctgtttattaatattga |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3188942 |
ttcttcaagcacttcaagtataaacaattatttcttctcattaatatgtgttctgttctgagcaatgtttaaatcagagtattctgtttattaatattga |
3188843 |
T |
|
| Q |
101 |
ataggcattttactatgagggaaaagcaactatgtcaaatgaagaatttgataatctcaaagaagaactcatgtgggaaggaagcagcgttgtaatgcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3188842 |
ataggcattttactatgagggaaaagcaactatgtcaaatgaagaatttgataatctcaaagaagaactcatgtgggaaggaagcagcgttgtaatgcta |
3188743 |
T |
|
| Q |
201 |
agtatgcaccaaaaacttcagtgaatttatgtacctatg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3188742 |
agtatgcaccaaaaacttcagtgaatttatgtacttatg |
3188704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 114 - 206
Target Start/End: Original strand, 42461454 - 42461546
Alignment:
| Q |
114 |
tatgagggaaaagcaactatgtcaaatgaagaatttgataatctcaaagaagaactcatgtgggaaggaagcagcgttgtaatgctaagtatg |
206 |
Q |
| |
|
||||||||||| || | |||||||||||||||||||||||||||||| || ||||| ||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
42461454 |
tatgagggaaaggctattatgtcaaatgaagaatttgataatctcaaggaggaacttatgtgggaaggaagcagtgttgtcatgctaagtatg |
42461546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University