View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14249_high_16 (Length: 224)
Name: NF14249_high_16
Description: NF14249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14249_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 15 - 183
Target Start/End: Complemental strand, 39446352 - 39446184
Alignment:
| Q |
15 |
ataaccaaacatttgagctcaattgttgatgaactccaccaataacgaattttttaggagaacttgggttcaattcttaagtgaaatattttttggtcaa |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||| |||| ||| ||||| |||||||| |||| |||| ||| |
|
|
| T |
39446352 |
ataaccaaacatttgacctcaattgttgatgaactccaccgataacaaattttttaggagaatttggattcgattctaaagtgaaacatttgttggccaa |
39446253 |
T |
 |
| Q |
115 |
attttacttatctcccaaccgaattcaggattacgagagcccttctcgttgaaactagagggtaaatac |
183 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39446252 |
attttatttctctcccaaccgaattcaggattacgagagcccttctcgttgaaaccagagggtaaatac |
39446184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 15 - 74
Target Start/End: Complemental strand, 39467689 - 39467630
Alignment:
| Q |
15 |
ataaccaaacatttgagctcaattgttgatgaactccaccaataacgaattttttaggag |
74 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
39467689 |
ataaccaaacatttgagattaattgttgatgaactccaccaaggacgatttttttaggag |
39467630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University