View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14249_high_6 (Length: 345)
Name: NF14249_high_6
Description: NF14249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14249_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 23 - 331
Target Start/End: Original strand, 11751634 - 11751931
Alignment:
| Q |
23 |
tattattaaacttggtgtcaattagattgtattgaccggcctctggtgggcgtggaggcaccgaaatatgatgtgtcttagtaatgaaacatggtctctc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11751634 |
tattattaaacttggtgtcaattagattgtattgac-----------gggcgtggaggcaccgaaatatgatgtgtcttagtaatgaaacatggtctctc |
11751722 |
T |
 |
| Q |
123 |
actcggctaagctttcaaattcagaatacagctgatactatcaaaaacagcttcaatgtcgtggctgttcatcctcaagacaggatggttcgctggaata |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11751723 |
actcggctaagctttcaaattcagaatacagctgatactatcaaaaacagcttcaatgtcgtggctgttcatcctcaagacaggatggttcgctggaata |
11751822 |
T |
 |
| Q |
223 |
gttttaatcacagttgtcatgtgctaaatgtggagagtggctgtctaggagtgccaattcgagctggttatgtaggtgttattcgaaattctacagggtt |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
11751823 |
gttttaatcacagttgtcatgtgctaaatgtggatagtagctgtctaggagtgccaattcgagctggttatgtaggtgttattcgatattttacagggtt |
11751922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 87 - 151
Target Start/End: Complemental strand, 32921147 - 32921083
Alignment:
| Q |
87 |
aatatgatgtgtcttagtaatgaaacatggtctctcactcggctaagctttcaaattcagaatac |
151 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||| || ||| |||| ||||| ||||| |
|
|
| T |
32921147 |
aatatgatgtgccttagtaatgaaacatggtctctaactcgactcagccttcacattcaaaatac |
32921083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 331
Target Start/End: Complemental strand, 7446274 - 7446180
Alignment:
| Q |
237 |
tgtcatgtgctaaatgtggagagtggctgtctaggagtgccaattcgagctggttatgtaggtgttattcgaaattctacagggttctatctctc |
331 |
Q |
| |
|
||||||||||| |||||||| || | ||| |||| ||||| ||||||||||||| || || |||||||| |||||| |||| ||||||||||| |
|
|
| T |
7446274 |
tgtcatgtgcttaatgtggacggtagttgtttaggtgtgcccattcgagctggttttggtggagttattcgcaattctgcaggtttctatctctc |
7446180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 66 - 98
Target Start/End: Original strand, 26743325 - 26743357
Alignment:
| Q |
66 |
tggtgggcgtggaggcaccgaaatatgatgtgt |
98 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
26743325 |
tggtgggcatggaggcaccgaaatatgatgtgt |
26743357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 66 - 118
Target Start/End: Complemental strand, 45715869 - 45715817
Alignment:
| Q |
66 |
tggtgggcgtggaggcaccgaaatatgatgtgtcttagtaatgaaacatggtc |
118 |
Q |
| |
|
|||||||| ||| | |||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
45715869 |
tggtgggcttggcgccaccgaaataacatgtgtcttagtaatgaaacttggtc |
45715817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 58 - 138
Target Start/End: Original strand, 7818738 - 7818818
Alignment:
| Q |
58 |
ccggcctctggtgggcgtggaggcaccgaaatatgatgtgtcttagtaatgaaacatggtctctcactcggctaagctttc |
138 |
Q |
| |
|
||||||| |||||| | ||||| ||||| ||| ||||||| || | | ||||||| ||||||||||||||| | ||||||| |
|
|
| T |
7818738 |
ccggcctatggtggacatggagacaccgtaatttgatgtgcctaaatcatgaaacttggtctctcactcggttgagctttc |
7818818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University