View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14249_low_10 (Length: 269)
Name: NF14249_low_10
Description: NF14249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14249_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 147 - 227
Target Start/End: Original strand, 18414203 - 18414283
Alignment:
| Q |
147 |
gcaaatttacaaataaaggtaagggaaagacagggaagacaccagaaacaacaactcagcataaatggtgactaaaaccgg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||| |
|
|
| T |
18414203 |
gcaaatttacaaataaaggtaagggaaagacagggaagacaccagaaacaacaactcaacataaatgatgagtaaaaccgg |
18414283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 13 - 78
Target Start/End: Original strand, 18414139 - 18414204
Alignment:
| Q |
13 |
cataggtacattttgtgataatattctaccgttactttcttttctatttgaaaaaagttttgttgc |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18414139 |
cataggtacattttgtgataatattctaccgttactttcttttttatttgaaaaaagttttgttgc |
18414204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University