View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14249_low_12 (Length: 263)
Name: NF14249_low_12
Description: NF14249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14249_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 67 - 252
Target Start/End: Complemental strand, 3766071 - 3765883
Alignment:
| Q |
67 |
gcatttggtgcagatgtggtggcatacgggactcatgtaccatcatttgctgattcatggggatgggttatggtatgc-nnnnnnntatatatacttcat |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3766071 |
gcatttggtgcagatgtggtggcatacgggactcatgtaccatcatttgctgattcatggggatgggttatggtatgcaaaaaaaaaatatatacttcat |
3765972 |
T |
|
| Q |
166 |
actttttttatcatgattatttgtgannnnnnnnnataaaacttc--tgttttgaattcaggcttcagaccaaccaatattgattgatg |
252 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3765971 |
actttttttatcatgattatttgtgatttttttttataaaacttctatgttttgaattcaggcttcagaccaaccaatattgattgatg |
3765883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 141
Target Start/End: Complemental strand, 48388514 - 48388470
Alignment:
| Q |
97 |
actcatgtaccatcatttgctgattcatggggatgggttatggta |
141 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
48388514 |
actcatgtaccatcttttgctgatacttggggatgggttatggta |
48388470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 141
Target Start/End: Original strand, 9995181 - 9995225
Alignment:
| Q |
97 |
actcatgtaccatcatttgctgattcatggggatgggttatggta |
141 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||| ||||| |
|
|
| T |
9995181 |
actcatgtaccatcttttgctgatacttggggatgggttttggta |
9995225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 141
Target Start/End: Complemental strand, 10359365 - 10359321
Alignment:
| Q |
97 |
actcatgtaccatcatttgctgattcatggggatgggttatggta |
141 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||| ||||| |
|
|
| T |
10359365 |
actcatgtaccatcttttgctgatacttggggatgggttttggta |
10359321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University