View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14249_low_21 (Length: 213)
Name: NF14249_low_21
Description: NF14249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14249_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 40812798 - 40812616
Alignment:
| Q |
18 |
cgaagcagaatttgaaaaaactgctatcttccggtttgtaaaccaactaaatatatgatgtattgtttgttacttcccacaaaccatatggatttggagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40812798 |
cgaagcagaatttgaaaaaactgctatctttcggtttgtagaccaccaaaatatatgatgtattgtttgttacttcccacaaaccatatggatttggagt |
40812699 |
T |
 |
| Q |
118 |
tcctgctatgggagttgaatgcgtgcatgcatgaacagttgaacacactgtgcctttgtatgtcatgaatctgttatgtgcct |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40812698 |
tcctgctgtgggagttgaatgcgtgcatgcatgaacagttgaacacactgtgcctttgtatgtcatgaatctgttatgtgcct |
40812616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University