View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14249_low_7 (Length: 345)

Name: NF14249_low_7
Description: NF14249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14249_low_7
NF14249_low_7
[»] chr3 (1 HSPs)
chr3 (23-331)||(11751634-11751931)
[»] chr1 (2 HSPs)
chr1 (87-151)||(32921083-32921147)
chr1 (237-331)||(7446180-7446274)
[»] chr8 (1 HSPs)
chr8 (66-98)||(26743325-26743357)
[»] chr7 (1 HSPs)
chr7 (66-118)||(45715817-45715869)
[»] chr5 (1 HSPs)
chr5 (58-138)||(7818738-7818818)


Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 23 - 331
Target Start/End: Original strand, 11751634 - 11751931
Alignment:
23 tattattaaacttggtgtcaattagattgtattgaccggcctctggtgggcgtggaggcaccgaaatatgatgtgtcttagtaatgaaacatggtctctc 122  Q
    ||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||||||||||||||||||||    
11751634 tattattaaacttggtgtcaattagattgtattgac-----------gggcgtggaggcaccgaaatatgatgtgtcttagtaatgaaacatggtctctc 11751722  T
123 actcggctaagctttcaaattcagaatacagctgatactatcaaaaacagcttcaatgtcgtggctgttcatcctcaagacaggatggttcgctggaata 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11751723 actcggctaagctttcaaattcagaatacagctgatactatcaaaaacagcttcaatgtcgtggctgttcatcctcaagacaggatggttcgctggaata 11751822  T
223 gttttaatcacagttgtcatgtgctaaatgtggagagtggctgtctaggagtgccaattcgagctggttatgtaggtgttattcgaaattctacagggtt 322  Q
    |||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||    
11751823 gttttaatcacagttgtcatgtgctaaatgtggatagtagctgtctaggagtgccaattcgagctggttatgtaggtgttattcgatattttacagggtt 11751922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 87 - 151
Target Start/End: Complemental strand, 32921147 - 32921083
Alignment:
87 aatatgatgtgtcttagtaatgaaacatggtctctcactcggctaagctttcaaattcagaatac 151  Q
    ||||||||||| ||||||||||||||||||||||| ||||| || ||| |||| ||||| |||||    
32921147 aatatgatgtgccttagtaatgaaacatggtctctaactcgactcagccttcacattcaaaatac 32921083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 331
Target Start/End: Complemental strand, 7446274 - 7446180
Alignment:
237 tgtcatgtgctaaatgtggagagtggctgtctaggagtgccaattcgagctggttatgtaggtgttattcgaaattctacagggttctatctctc 331  Q
    ||||||||||| ||||||||  || | ||| |||| ||||| ||||||||||||| ||  || |||||||| |||||| |||| |||||||||||    
7446274 tgtcatgtgcttaatgtggacggtagttgtttaggtgtgcccattcgagctggttttggtggagttattcgcaattctgcaggtttctatctctc 7446180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 66 - 98
Target Start/End: Original strand, 26743325 - 26743357
Alignment:
66 tggtgggcgtggaggcaccgaaatatgatgtgt 98  Q
    |||||||| ||||||||||||||||||||||||    
26743325 tggtgggcatggaggcaccgaaatatgatgtgt 26743357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 66 - 118
Target Start/End: Complemental strand, 45715869 - 45715817
Alignment:
66 tggtgggcgtggaggcaccgaaatatgatgtgtcttagtaatgaaacatggtc 118  Q
    |||||||| ||| | ||||||||||  |||||||||||||||||||| |||||    
45715869 tggtgggcttggcgccaccgaaataacatgtgtcttagtaatgaaacttggtc 45715817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 58 - 138
Target Start/End: Original strand, 7818738 - 7818818
Alignment:
58 ccggcctctggtgggcgtggaggcaccgaaatatgatgtgtcttagtaatgaaacatggtctctcactcggctaagctttc 138  Q
    ||||||| |||||| | ||||| ||||| ||| ||||||| || | | ||||||| ||||||||||||||| | |||||||    
7818738 ccggcctatggtggacatggagacaccgtaatttgatgtgcctaaatcatgaaacttggtctctcactcggttgagctttc 7818818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University