View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14249_low_8 (Length: 336)
Name: NF14249_low_8
Description: NF14249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14249_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 17 - 73
Target Start/End: Complemental strand, 51376285 - 51376229
Alignment:
| Q |
17 |
cataggtaataggtattgaaggaacacttatgtaaatgactaaaagaggattggaaa |
73 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
51376285 |
cataggtaataggtattgaaggaacacttctgtaaatgaataaaagaggattggaaa |
51376229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 91 - 136
Target Start/End: Original strand, 51821029 - 51821074
Alignment:
| Q |
91 |
cttttaggtaagcctttattccatcatgaaagaaatttgactcttg |
136 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
51821029 |
cttttaggtaagtctttattatatcatgaaagaaaattgactcttg |
51821074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University