View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14249_low_8 (Length: 336)

Name: NF14249_low_8
Description: NF14249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14249_low_8
NF14249_low_8
[»] chr1 (2 HSPs)
chr1 (17-73)||(51376229-51376285)
chr1 (91-136)||(51821029-51821074)


Alignment Details
Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 17 - 73
Target Start/End: Complemental strand, 51376285 - 51376229
Alignment:
17 cataggtaataggtattgaaggaacacttatgtaaatgactaaaagaggattggaaa 73  Q
    ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||    
51376285 cataggtaataggtattgaaggaacacttctgtaaatgaataaaagaggattggaaa 51376229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 91 - 136
Target Start/End: Original strand, 51821029 - 51821074
Alignment:
91 cttttaggtaagcctttattccatcatgaaagaaatttgactcttg 136  Q
    |||||||||||| |||||||  ||||||||||||| ||||||||||    
51821029 cttttaggtaagtctttattatatcatgaaagaaaattgactcttg 51821074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University