View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14250_low_6 (Length: 263)

Name: NF14250_low_6
Description: NF14250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14250_low_6
NF14250_low_6
[»] chr2 (1 HSPs)
chr2 (9-244)||(15241713-15241941)
[»] chr6 (1 HSPs)
chr6 (46-104)||(34227386-34227444)
[»] chr1 (1 HSPs)
chr1 (56-104)||(33651744-33651792)


Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 9 - 244
Target Start/End: Complemental strand, 15241941 - 15241713
Alignment:
9 gagaagcaaaggactcgaccaaaacacagaacaaaatatcagtgttttcaaatgcagatcacggaaaatgatagtttgttcaaatttaactacacaccac 108  Q
    ||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15241941 gagaatcaaaagacttgaccaaaacacagaacaaaatatcagtgttttcaaatgcagatcacggaaaatgatagtttgttcaaatttaactacacaccac 15241842  T
109 accactatatatagacctatttgacaacattttatgctaatagagagtattgaaaaacagcaatattgtaaacgatttactgcaacaaaagaacatcatt 208  Q
    |||||    |||||||||||||||||||||||| |||||||||||||||||| ||||   ||| ||||||||||||||||||||||||||||||||||||    
15241841 accac----tatagacctatttgacaacattttgtgctaatagagagtattgcaaaa---caacattgtaaacgatttactgcaacaaaagaacatcatt 15241749  T
209 aacgtcacattatcatataacaacaagaagggataa 244  Q
    ||||||||||||||||||||||||||||||||||||    
15241748 aacgtcacattatcatataacaacaagaagggataa 15241713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 104
Target Start/End: Complemental strand, 34227444 - 34227386
Alignment:
46 atcagtgttttcaaatgcagatcacggaaaatgatagtttgttcaaatttaactacaca 104  Q
    ||||||||| |||| ||| ||||| ||||||| | ||||||||||||||| ||||||||    
34227444 atcagtgttgtcaattgccgatcatggaaaataacagtttgttcaaatttcactacaca 34227386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 56 - 104
Target Start/End: Complemental strand, 33651792 - 33651744
Alignment:
56 tcaaatgcagatcacggaaaatgatagtttgttcaaatttaactacaca 104  Q
    |||| |||||||||| ||||||  ||||||||||||||||| |||||||    
33651792 tcaattgcagatcacagaaaatagtagtttgttcaaatttagctacaca 33651744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University