View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14250_low_7 (Length: 240)
Name: NF14250_low_7
Description: NF14250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14250_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 16 - 224
Target Start/End: Original strand, 16923528 - 16923730
Alignment:
| Q |
16 |
atatatactgatgtgacaaacatgattgtaatgtactaaatagatacaaaaaatcttatgagatctaattaatctcatgagtaaattcatgttgaattta |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16923528 |
atatacactgatgtgacaaacatgattgtaatgtactaaatagatacaaaaaatcttatgagatctaattaatctcatgagtaaattcatgttgaattta |
16923627 |
T |
|
| Q |
116 |
attctcttctacacaaggacacaaacacaacaacagacataggtaataattgaaagacaaaattagttctcttaccaactatattcctatgctaatagta |
215 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16923628 |
attctcttctacacgagg------acacaacaacagacataggtaataattgaaagacaaatttagttctcttaccaactatattcctatactaatagta |
16923721 |
T |
|
| Q |
216 |
gtcctatat |
224 |
Q |
| |
|
|| |||||| |
|
|
| T |
16923722 |
gttctatat |
16923730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University