View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14251_low_23 (Length: 225)
Name: NF14251_low_23
Description: NF14251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14251_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 210
Target Start/End: Original strand, 32820294 - 32820484
Alignment:
| Q |
20 |
accatctcatccatgccagtgacaatttcttccatggaattttcactctcatttctcatgcttcgttcgtttatatctatctcaatcattgcacccacac |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32820294 |
accatctcatccatgccagtgacagtttcttccatggaattttcactctcatttctcatgcttcgttcgtttatatctatctcaatcattgcacccacac |
32820393 |
T |
|
| Q |
120 |
taccttactcttccactcattctttattctgacttcctaccgaagtaacttttctttttgtttccatcttcacaaccatggcatgcctatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32820394 |
taccttactcttccactcattctttattctgacttcctaccgaagtaacttttctttttgtttccatcttcacaaccatggcatgcttatg |
32820484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University