View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14252_low_3 (Length: 288)
Name: NF14252_low_3
Description: NF14252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14252_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 28 - 272
Target Start/End: Original strand, 6990584 - 6990844
Alignment:
| Q |
28 |
cattgtcatcaactatgttctttataatccagtctttcattttcaattggttaacaatggcaaagaggcaggtacaagtttttcgaactagatcaatttc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6990584 |
cattgtcatcaactatgttctttataatccagtctttcattttcaattggttaacaatggcaaagaggcaggtacaagtttttcgaaccagatcaatttc |
6990683 |
T |
 |
| Q |
128 |
tttttgccctagagtttc-ttcatataacttcactttctatccaaattaagcaaaggaagaacaagtttttact---------------tttctctcaca |
211 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6990684 |
tttttgcctaagagtttctttcatataacttcactttctatccaaattaagcaaaggaagaacaagtttttacttttctctactttccctttctctcaca |
6990783 |
T |
 |
| Q |
212 |
ataactaaaaattcatcacactttggtctctttaacaagacatgttttcgagcttataact |
272 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6990784 |
ataactaaaaattcatcacactttagtctctttaacaagacatattttcgagcttataact |
6990844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University