View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14252_low_4 (Length: 260)
Name: NF14252_low_4
Description: NF14252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14252_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 37 - 256
Target Start/End: Original strand, 33299389 - 33299607
Alignment:
| Q |
37 |
gtaaatactattatctgagatatgattatttcttctttggcaggatgtctttactagtgggattggttgggcattatttggaggacttccatatgatttg |
136 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33299389 |
gtaaatactattatctgaaatatgattatttattctttggcaggatgtctttactagtgggattggttgggcattatttggaggacttccatatgatttg |
33299488 |
T |
|
| Q |
137 |
gtaaacacaaatctctttagggacttgaattctatattgtattaattttttatattatgggaacttataatatcttatgtttttcttggtatgcagttca |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
33299489 |
gtaaacacaaatctctttagggacttgaattctatattgtattaattttttatattatgggaacttataatatcttatg-ttttgttggtatgcagttca |
33299587 |
T |
|
| Q |
237 |
atgttcttggtcaaaccctt |
256 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33299588 |
atgttcttggtcaaaccctt |
33299607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University