View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14254_high_20 (Length: 234)

Name: NF14254_high_20
Description: NF14254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14254_high_20
NF14254_high_20
[»] chr3 (1 HSPs)
chr3 (148-216)||(12698525-12698593)


Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 148 - 216
Target Start/End: Original strand, 12698525 - 12698593
Alignment:
148 gcactataaaattgatccaaaaaattcgcttgcctgcctgaaaaaattcgtagtataatagttaacttt 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
12698525 gcactataaaattgatccaaaaaattcgcttgcctgcctgaaaaaattcgtagtataatagtaaacttt 12698593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University