View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14254_high_27 (Length: 205)

Name: NF14254_high_27
Description: NF14254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14254_high_27
NF14254_high_27
[»] chr5 (1 HSPs)
chr5 (18-193)||(28454479-28454652)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 28454652 - 28454479
Alignment:
18 gaagatccatgcactgcactgcacccaataatcagtgcttcacatgctatgctactggacaacccgacaaccgtatccaacactgtcacagtatctctat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28454652 gaagatccatgcactgcactgcacccaataatcagtgcttcacatgctatgctactggacaacccgacaaccgtatccaacactgtcacagtatctctat 28454553  T
118 tgtttaatgcaaatgactcaaaccatcaccaagcacaacatttttattccgagttctcggctagcaacactttctt 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |  |||||||| |||||||||||    
28454552 tgtttaatgcaaatgactcaaaccatcaccaagcacaacatttttattccgact--tcggctagtaacactttctt 28454479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University