View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14254_low_26 (Length: 231)
Name: NF14254_low_26
Description: NF14254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14254_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 11 - 146
Target Start/End: Original strand, 10252386 - 10252521
Alignment:
| Q |
11 |
agagagaagaatctaacttcagaaattgtacaacatgaatcactttgctaagtttcatcttcatatttaatatttttatcttatgtgatcaccgtccatg |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10252386 |
agagaaaagaatctaacttcagaaattgtacaacctgaatcactttgctaagtttcatcttcatatttaatatttttatctgatgtgatcaccgtccatg |
10252485 |
T |
 |
| Q |
111 |
gcagaacaaaaagcatttaacattggccagccatac |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10252486 |
gcagaacaaaaagcatttaacattggccagccatac |
10252521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University