View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14254_low_27 (Length: 220)
Name: NF14254_low_27
Description: NF14254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14254_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 38985596 - 38985788
Alignment:
| Q |
17 |
attcttttagccctacgataaaataattnnnnnnnnntgtatataagaaaaataatgacatatattgtggacaaaagggagtaggttagtaaaatttgtc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38985596 |
attcttttagccctacgataaaataattaaaaaaaaatgtatataagaaaaataatgacatatattgtggacaaaagggagtaggttagtaaaatttgtc |
38985695 |
T |
|
| Q |
117 |
cgagaaataagctgtccataaaattacgtgttattccatccctggtgttgtgtgtaacgttttctcacttttttgcgtcaaaaagaataattt |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38985696 |
cgagaaataagctgtccgtaaaattacgtgttattccatccctggtgttgtgtgtaacgttttctcacttttttgcgtcaaaaagaataattt |
38985788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University