View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14254_low_31 (Length: 205)
Name: NF14254_low_31
Description: NF14254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14254_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 28454652 - 28454479
Alignment:
| Q |
18 |
gaagatccatgcactgcactgcacccaataatcagtgcttcacatgctatgctactggacaacccgacaaccgtatccaacactgtcacagtatctctat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28454652 |
gaagatccatgcactgcactgcacccaataatcagtgcttcacatgctatgctactggacaacccgacaaccgtatccaacactgtcacagtatctctat |
28454553 |
T |
|
| Q |
118 |
tgtttaatgcaaatgactcaaaccatcaccaagcacaacatttttattccgagttctcggctagcaacactttctt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||| |
|
|
| T |
28454552 |
tgtttaatgcaaatgactcaaaccatcaccaagcacaacatttttattccgact--tcggctagtaacactttctt |
28454479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University