View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14257_high_13 (Length: 265)
Name: NF14257_high_13
Description: NF14257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14257_high_13 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 27 - 265
Target Start/End: Complemental strand, 18096008 - 18095775
Alignment:
| Q |
27 |
attggcatagtcattgttgttgcccacttgaaaaggaaagagattggcgttggcattgttaccaccacccacttgaacaggaaaaagattggcattttca |
126 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18096008 |
attggcattgtcattgttgttgcccacttgaaaaggaaagagattggcgttggcattgttaccaccacccacttgaaaaggaaaaagattggcattttca |
18095909 |
T |
|
| Q |
127 |
tcacccacatcaccctctagaaaagcaatgtcattgacattgatttcgttaccaccacccatttgaaaaggaaaaggaaattgattggcattgtcacctt |
226 |
Q |
| |
|
|||||||| | | | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18095908 |
tcacccacttgaa-----aaaaaagcaaagtcattgacattgatttcgttaccaccacccatttgaaaaggaaaaggaaattgattggcattgtcacctt |
18095814 |
T |
|
| Q |
227 |
gctgttgaagaggaagtggccattccaaattagccctaa |
265 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18095813 |
gctgttgaagaggaagtggccaatccaaattagccctaa |
18095775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 210 - 264
Target Start/End: Complemental strand, 18081613 - 18081559
Alignment:
| Q |
210 |
attggcattgtcaccttgctgttgaagaggaagtggccattccaaattagcccta |
264 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18081613 |
attggcattgttaccttgttgttgaagaggaagtggccattccaaattaacccta |
18081559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University