View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14258_high_30 (Length: 246)
Name: NF14258_high_30
Description: NF14258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14258_high_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 1193874 - 1194083
Alignment:
| Q |
18 |
aaaaaactcaaattttatatttttcaagttggatatgtgtccaattgcgcatgaattttgcaaaattttcatggcaaaatggaaataatttaatacttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1193874 |
aaaaaactcaaattttatatttttcatgttggatatgtgtccaattgcgcatgaatt--gcaaaattttcatggcaaaatggaaataatttaatacttct |
1193971 |
T |
|
| Q |
118 |
cgatatataa-ccaaaaatttagaaaatacatagttggcatccttgttaatttattttctgtttttgttggtgctctttcaataaaggcactatgac-tt |
215 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
1193972 |
cgatatataaaccaaaaattcagaaaatacatagttggcatccttgttaatttattttctgtttttgttggtgctctttcaataaaggcaatatgacttt |
1194071 |
T |
|
| Q |
216 |
tgtaaatatttt |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1194072 |
tgtaaatatttt |
1194083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University