View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14258_low_19 (Length: 378)
Name: NF14258_low_19
Description: NF14258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14258_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 9e-52; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 6089169 - 6089062
Alignment:
| Q |
1 |
gttgctgattcttctttgatgatggaatctcctttggaaagattgagtgaagaagatccatttggtgatggtcgtaataaatcaagattgttgactatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6089169 |
gttgctgattcttctttgatgatggaatctcctttggaaagattgagtgaagaagatccatttggtgatggtcgcaataaatcaagattgttgactatgc |
6089070 |
T |
 |
| Q |
101 |
ttgatgag |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
6089069 |
ttgatgag |
6089062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 306 - 366
Target Start/End: Complemental strand, 6088874 - 6088814
Alignment:
| Q |
306 |
gtctcttagattaatattaatatagttaattatatctagattaatttccatttttaatttt |
366 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6088874 |
gtctcttagattagtattaatatacttaattatatctagattaatttccatttttaatttt |
6088814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 247 - 288
Target Start/End: Complemental strand, 6088903 - 6088862
Alignment:
| Q |
247 |
gtcattttgtggatggacttactgttttagtctcttagatta |
288 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6088903 |
gtcattttgtggatggacttactggtttagtctcttagatta |
6088862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University