View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14258_low_37 (Length: 246)

Name: NF14258_low_37
Description: NF14258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14258_low_37
NF14258_low_37
[»] chr4 (1 HSPs)
chr4 (18-227)||(1193874-1194083)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 1193874 - 1194083
Alignment:
18 aaaaaactcaaattttatatttttcaagttggatatgtgtccaattgcgcatgaattttgcaaaattttcatggcaaaatggaaataatttaatacttct 117  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||    
1193874 aaaaaactcaaattttatatttttcatgttggatatgtgtccaattgcgcatgaatt--gcaaaattttcatggcaaaatggaaataatttaatacttct 1193971  T
118 cgatatataa-ccaaaaatttagaaaatacatagttggcatccttgttaatttattttctgtttttgttggtgctctttcaataaaggcactatgac-tt 215  Q
    |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||    
1193972 cgatatataaaccaaaaattcagaaaatacatagttggcatccttgttaatttattttctgtttttgttggtgctctttcaataaaggcaatatgacttt 1194071  T
216 tgtaaatatttt 227  Q
    ||||||||||||    
1194072 tgtaaatatttt 1194083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University